Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM6

[Submit comment/correction]

Locus	HVM6
Type	Microsatellite
Synonym	Correct name HVM006 Synonym HVM6
Chromosome	5H
Chromosome Arm	5HL
Map	Hordeum-Consensus2005-SNP-5H 190.665 [ Show all 8 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QLof.pil-5H.2 QYld.pil-5H.4
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM6 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Number of populations contributing to the placement of HVM6 in the Barley, Consensus 2006 DArT maps = 1
Probe	HVM6
Locus	HVM6 HVM0006 HVM006 HVM06
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks	Insert contains repeat (GA)9.
Type	PCR SSR
PCR primers	5' CATGAATGAATGATTGGTTTTG 3' 5' CGCATCCGTATGTATGAGTAA 3' CATGAATGAATGATTGGTTTTG CGCATCCGTATGTATGAGTAA
SSR size	0.175
Amplification Conditions	The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.