Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM4

[Submit comment/correction]

Locus	HVM4
Type	Microsatellite
Synonym	Correct name HVM004
Chromosome	7H
Chromosome Arm	7HS
Map	Hordeum-Graner2-7H 27.5 [ Show all 6 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHi.pil-7H.1
Map Data	Barley, AxHs/QTL [ Show all 6 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM4 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Probe	HVM4
Locus	HVM4 HVM0004 HVM004 HVM04
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
Remarks	Insert contains repeat (AT)9.
Type	PCR SSR
PCR primers	5' AGAGCAACTACCAGTCCAATGGCA 3' 5' GTCGAAGGAGAAGCGGCCCTGGTA 3' AGAGCAACTACCAGTCCAATGGCA GTCGAAGGAGAAGCGGCCCTGGTA
SSR size	0.198
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	X07931
Insert Enzyme	TaqI
Source Gene Class	Starch synthase
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.