Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM3

[Submit comment/correction]

Locus	HVM3
Type	Microsatellite
Synonym	Correct name HVM003 Synonym HVM3
Chromosome	4H 5H
Chromosome Arm	4HL
Map	Barley-consensus-2003-5H 31.4 [ Show all 13 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 13 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVM3 Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of HVM3 in the Barley, Consensus 2006 DArT maps = 1
Probe	HVM3
Locus	HVM3 HVM0003 HVM003 HVM03 HVM03-4H
Reference	Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
Remarks	Insert contains repeat (AT)29. In 369 Avena sterilis accessions there were 3 alleles of size 138-142 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' ACACCTTCCCAGGACAATCCATTG 3' 5' AGCACGCAGAGCACCGAAAAAGTC 3' ACACCTTCCCAGGACAATCCATTG AGCACGCAGAGCACCGAAAAAGTC
SSR size	0.188
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	M55449
Insert Enzyme	TaqI
Source Gene Class	Ribulose bisphosphate carboxylase activase
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.