Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM11a

[Submit comment/correction]

Locus	HVM11a
Type	Microsatellite
Chromosome	6H
Map	Barley-consensus-2003-6H 7.2 Barley-ConsensusFHB-6H 83.01 Hordeum-Consensus2007-SSR-6H 88.47 Hordeum-LxHs-6H 84
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM11
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
Data Source	Langridge, Peter J.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (GGA)3,(GGA), (GAA)2 Developing laboratory = VPISU (MA Saghai Maroof)
Probe for Locus	HVM11
Locus	HVM11 HVM11a HVM11b HVM011
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
General Remarks	Glucose-regulated protein (GRP94 homologue, heat-shock protein 90). Insert contains repeats (GGA)3, (GGA), and (GGA)2.
Type	PCR SSR
PCR primers	5' CCGGTCGGTGCAGAAGAG 3' 5' AAATGAAAGCTAAATGGGCGATAT 3' CCGGTCGGTGCAGAAGAG AAATGAAAGCTAAATGGCGATAT
SSR size	0.181
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	X67960
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.