Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM05

[Submit comment/correction]

Locus	HVM05
Type	Microsatellite
Synonym	Correct name HVM5
Chromosome	7H
Map	Barley-ConsensusFHB-7H 156.6 Hordeum-Consensus2007-SSR-7H 148.22 Hordeum-FxS-FHB-QTL-7H 210.8 Hv-Consensus2006-Marcel-7H 148.22 Hv-Integrated2009-7H 148.1
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009
Species	Hordeum spontaneum Hordeum vulgare
Probe	HVM05 HVM5
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant, Lina x H. spontaneum Developing laboratory = VPISU (MA Saghai Maroof)
Probe for Locus	HVM5
Locus	HVM5 HVM005 HVM05
Reference	Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
General Remarks	Pathogenesis-related protein Insert contains repeats (GT)6 and (AT)16.
Type	PCR SSR
PCR primers	5' AACGACGTCGCCACACAC 3' 5' AGGAACGAAGGGAGTATTAAGCAG 3'
SSR size	0.202
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	X58566
Insert Enzyme	TaqI
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.