Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVM04

[Submit comment/correction]

Locus	HVM04
Type	Microsatellite
Chromosome	7H
Map	Barley-ConsensusFHB-7H 25.6 Hordeum-Consensus2007-SSR-7H 22.19 Hv-Consensus2006-Marcel-7H 22.19 Hv-Integrated2009-7H 22.7
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	HVM4
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe for Locus	HVM4
Locus	HVM4 HVM0004 HVM004 HVM04
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876. Saghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
General Remarks	Insert contains repeat (AT)9.
Type	PCR SSR
PCR primers	5' AGAGCAACTACCAGTCCAATGGCA 3' 5' GTCGAAGGAGAAGCGGCCCTGGTA 3' AGAGCAACTACCAGTCCAATGGCA GTCGAAGGAGAAGCGGCCCTGGTA
SSR size	0.198
Amplification Conditions	PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence	X07931
Insert Enzyme	TaqI
Source Gene Class	Starch synthase
Source Species	Hordeum vulgare
Source Germplasm	Old ZZ (barley)
DNA Origin	Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.