Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: H13

[Submit comment/correction]

Locus	H13
Type	Gene Trait
Chromosome	6D
Chromosome Arm	6DL 6DS
Map	Triticum-Genes-6D 46.4 Wheat-Composite2004-6D 49
	[ Show Nearby Loci ]
Map Data	Wheat genes
2 Point Data	Centromere/H13#1 Distance: 35 cM H13/H23#1 Distance: 25 cM
Species	Triticum aestivum
Probe	CFD132
Associated Gene	H13 (Triticum)
Gene Class	Reaction to Mayetiola destructor (Say) (Phytophaga destructor) (Say)
Reference	Liu X. et al. (2005) Hessian fly resistance gene H13 is mapped to a distal cluster of resistance genes in chromosome 6DS of wheat Theoretical and Applied Genetics 111:243-249. Gill BS et al. (1987) Chromosomal mapping of Hessian fly resistance gene H13 in the D genome of wheat. Journal of Heredity 78:97-100.
Data Source	Matthews, David E.
Remark	Trait marker Xcfd132 Nearby marker on Composite map: Xcfd132 Position on Composite map estimated by GrainGenes.
Probe for Locus	CFD132
Locus	Xcfd132-6D H13 Xcfd132 cfd132
Reference	Guyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks	Quality Score = B Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (CT)6(CA)19 Regularity of motif is perfect
Type	PCR SSR
PCR primers	Forward 5' CAAATGCTAATCCCCGCC 3' Reverse 5' TGTAAACAAGGTCGCAGGTG 3'
SSR size	150
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	6D
Source Species	Aegilops tauschii