Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Gb3

[Submit comment/correction]

Locus	Gb3
Type	Trait
Chromosome	7D
Chromosome Arm	7DL
Map	Wheat-Composite2004-7D 231
	[ Show Nearby Loci ]
2 Point Data	Gb3/Xwmc634 Distance: 0 cM
Species	Triticum aestivum
Probe	WMS37
Associated Gene	Gb3 (Triticum)
Gene Class	Reaction to Schizaphis graminum Rond. (Toxoptera graminum Rond.)
Reference	Weng Y et al. (2005) Microsatellite markers associated with two-derived greenbug resistance loci in wheat Theoretical and Applied Genetics 110:462-469.
Remark	Trait marker Xgwm37-7D Nearby marker on Composite map: Xgwm37 Position on Composite map estimated by GrainGenes.
Probe for Locus	WMS37
Locus	Xgwm37-7D [ Show all 8 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (AG)8GG(AG)21 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (AG)x8GG(AG)x21. Product size 193 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' ACTTCATTGTTGATCTTGCATG 3' 5' CGACGAATTCCCAGCTAAAC 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS37
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring