Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS6

[Submit comment/correction]

Locus	GMS6
Type	Microsatellite
Synonym	Synonym GMS006
Chromosome	6H
Map	Barley-consensus-2003-6H 4.7 Hordeum-Consensus2006-DArT-6H 65.2
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT
Probe	GMS6
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of GMS6 in the Barley, Consensus 2006 DArT maps = 2
Probe	GMS6
Locus	GMS0006 GMS006 GMS6
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Waugh R and Marshall DF (2005) Barley SSRs from the Scottish Crop Research Institute. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remarks	SSR motif: (GA)2ATA(GA)19
Type	SSR
PCR primers	TGACCAGTAGGGGCAGTTTC TTCTTCTCCCTCCCCCAC
SSR size	154
Amplification Conditions	35-45 cycles: 1 min @ 94C, 1 min @ 55C, 2 min @ 72C; 1 cycle: 60 mins @ 72C.