Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS2

[Submit comment/correction]

Probe	GMS2
Locus	GMS0002 GMS002
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Waugh R and Marshall DF (2005) Barley SSRs from the Scottish Crop Research Institute. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remarks	SSR motif: (CT)18
Type	SSR
PCR primers	CCGACAACATGCTATGAAGC CTGCAGCAAATACCCATGTG Forward CCGACAACATGCTATGAAGC Reverse CTGCAGCAAATACCCATGTG
SSR size	131
Amplification Conditions	35-45 cycles: 1 min @ 94C, 1 min @ 60C, 2 min @ 72C; 1 cycle: 60 mins @ 72C.