Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS1

[Submit comment/correction]

Locus	GMS1
Type	Microsatellite
Synonym	Synonym GMS001
Chromosome	5H
Map	Barley-consensus-2003-5H 105.7 Hordeum-Consensus2006-DArT-5H 188.8 Hordeum-Pillen-5H 187
	[ Show Nearby Loci ]
QTL with Locus Marker	QHea.pil-5H.5 QMe.ChHa-5H QTgw.pil-5H.4
Map Data	Barley consensus 2003 Barley, AxHs/QTL Barley, Consensus 2006, DArT
Probe	GMS1
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of GMS1 in the Barley, Consensus 2006 DArT maps = 1
Probe	GMS1
Locus	GMS0001 GMS001 GMS1
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Waugh R and Marshall DF (2005) Barley SSRs from the Scottish Crop Research Institute. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remarks	SSR motif: (CT)7TTT(CT)2
Type	SSR
PCR primers	CTGACCCTTTGCTTAACATGC TCAGCGTGACAAACAATAAAGG
SSR size	134
Amplification Conditions	35-45 cycles: 1 min @ 94C, 1 min @ 60C, 2 min @ 72C; 1 cycle: 60 mins @ 72C.