Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac906

[Submit comment/correction]

Locus	EBmac906
Type	Microsatellite
Synonym	Synonym EBmac0906
Chromosome	4H
Map	Barley-consensus-2003-4H 26.9 Hordeum-Consensus2006-DArT-4H 66.5 Hordeum-SxM-SSR-4H 66.5
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Igri x Franka, SSR Barley, Steptoe x Morex, SSR
Probe	EBmac906
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of EBmac906 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	EBmac0906
Probe	EBmac906
Locus	EBmac0906 EBmac906
Synonym	Other name EBmac0906
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (GC)5GGG(GT)16 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.75
Type	PCR SSR
PCR primers	5' CAAATCAATCAAGAGGCC 3' 5' TTTGAAGTGAGACATTTCCA 3' CAAATCAATCAAGAGGCC TTTGAAGTGAGACATTTCCA
SSR size	153
Amplification Conditions	1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare