Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac854

[Submit comment/correction]

Locus	EBmac854
Type	Microsatellite
Chromosome	5H
Map	Hordeum-Consensus2006-DArT-5H 74.6
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT
Probe	EBmac0854
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of EBmac854 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	EBmac0854
Probe for Locus	EBmac0854
Locus	EBmac0854 EBmac854
Synonym	Other name EBmac854
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	GTCGATATAACGCACTTTCA ATTCCCTCTAACACACCAAC