Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac806

[Submit comment/correction]

Locus	EBmac806
Type	Microsatellite
Synonym	Synonym EBmac0806
Chromosome	6H
Map	Barley-consensus-2003-6H 56.1 Hordeum-Consensus2006-DArT-6H 80.2 Hordeum-SxM-SSR-6H 91.1
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Steptoe x Morex, SSR
Probe	EBmac806
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of EBmac806 in the Barley, Consensus 2006 DArT maps = 2
Possible Orthologs	EBmac0806
Probe	EBmac806
Locus	EBmac0806 EBmac806
Synonym	Other name Bmac806 EBmac0806
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (CA)4GA(CA)8,(CA)5 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.78
Type	PCR SSR
PCR primers	5' ACTAAGTCCTTTCACGAGGA 3' 5' GTGTGTAGTAGGTGGGTACTTG 3'
SSR size	168
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare