Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac0602

[Submit comment/correction]

Locus	EBmac0602
Type	Microsatellite
Synonym	Synonym EBmac602
Chromosome	6H
Map	Barley, B73xCPI-6H 54.6 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 10 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac602 EBmac0602 EBmac602
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Possible Orthologs	Bmac602 EBmac602
Probe for Locus	Bmac602
Locus	EBmac0602 Bmac602
Synonym	Other name EBmac0602 EBmac602
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	GATTGGAGCTTCGGATCAC CCGTCTAGGGAGAGGTTCTC