Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac0541

[Submit comment/correction]

Locus	EBmac0541
Type	Microsatellite
Chromosome	3H
Map	Barley, B73xCPI-3H 118.2 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI [ Show all 7 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	EBmac0541 EBmac541
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Possible Orthologs	Bmac0541 EBmac541
Probe for Locus	EBmac541
Locus	EBmac0541 EBmac541
Synonym	Other name EBmac0541
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)9 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.26
Type	PCR SSR
PCR primers	5' ACGGATCTACTTTAGCTAGCA 3' 5' AAACAACCCCACACAATC 3' ACGGATCTACTTTAGCTAGCA AAACAACCCCACACAATC
SSR size	106
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare