Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Dhn6-4H

[Submit comment/correction]

Locus	Dhn6-4H
Map	Hv-DxR-Stein-4H 41.82 Hv-IxF-Stein-4H 63
	[ Show Nearby Loci ]
Map Data	Barley, IxF, Stein2006 Barley, OWB, Stein2006
Probe	Dhn6
Probe for Locus	Dhn6
Locus	Dhn6 Dhn6-4H
Synonym	Other name HV2
Reference	Choi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354. Kleinhofs A (1992) The NABGMP mapping progress report, spring 1992 Barley Genetics Newsletter 21:38-48.
General Remarks	Size in Dicktoo (bp) = 976 Size in Morex (bp) = 517 dehydrin
Type	Genomic PCR STS
PCR primers	5' CAATCCGTGAAGCGAAGAGATGG 3' ACCAGGCCATGTCACAGTACTGC
Amplification Conditions	Annealing temp. = 62
Sequence	AF181456
Linkage Group	Group 4
Source Species	Hordeum vulgare
Insert Size	1.8