Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Dhn3

[Submit comment/correction]

Gene	dhn3
Candidate Locus	Xttu1937(Wsip16)[XDhn3]
Gene Product	dehydrin 3
Sequence	AM180927 AM180927_1.cds
Locus Candidate for Gene	Xttu1937(Wsip16)[XDhn3]
Type	RFLP
Chromosome	6D
Chromosome Arm	6DL
Map	Ta-Physical-Gill-6ABD 95 Ta-Physical-Gill-6D 3.46
	[ Show Nearby Loci ]
Breakpoint Interval	6DL-1/0 6L-0.89-1.00
Map Data	Wheat, Physical
Species	Triticum aestivum
Probe	pTZ19R-dhn3
Candidate Gene	dhn3
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Locus	Dhn3
Type	RFLP STS
Chromosome	6H
Map	Barley-Consensus2-6H 101.7 Hordeum-Bins-6H 110 Hordeum-DxM-Dnh-6H 95.8 Hordeum-NABGMP2-6H 120.4 Hv-Integrated2009-6H 101.9
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, BinMap 2005 Barley, DxM, Dhn genes Barley, HxT Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	Dhn3
Reference	Choi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Nure x Tremois
Possible Orthologs	Xucr.Dhn3,4
Probe	Dhn3
Locus	XDhn3,4 Xucr.Dhn3,4 Dhn3
Synonym	Other name B17
Reference	Choi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354. Close TJ et al. (1989) A cDNA-based comparison of dehydration-induced proteins (dehydrins) in barley and corn. Plant Molecular Biology 13:95-108.
Remarks	Barley dehydrin gene 3 Size in Dicktoo (bp) = 104 Size in Morex (bp) = 65 B17-dehydrin
Type	cDNA PCR STS
PCR primers	5' AGGCAACCAAGATCAACACCACCTG 3' GCGGAAGTTTTACTGCATCTCCATC
Amplification Conditions	Annealing temp. = 62
Linkage Group	Group 6
Source Gene Class	16.2 kDa dehydrin
Source Gene	Dhn3 (Hordeum)
Source Species	Hordeum vulgare
Insert Size	0.812