Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: CFP5109

[Submit comment/correction]

Locus	cfp5109
Map	Physical-3B 58.4
	[ Show Nearby Loci ]
Map Data	3B Physical
Probe	CFP5109
Probe	CFP5109
Locus	cfp5109
Reference	Paux E et al. (2008) A Physical Map of the 1-Gigabase Bread Wheat Chromosome 3B Science 322:101-104.
Type	PCR
PCR primers	Left (5'-3'):CCGATCGGGAAGTTAGATGA Right (5'-3'):AGTCCGGGTGACGATGATAG
STS size	261
Sequence	FI160981