Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: CFP2166

[Submit comment/correction]

Locus	cfp2166
Map	Physical-3B 59.23
	[ Show Nearby Loci ]
Map Data	3B Physical
Probe	CFP2166
Probe	CFP2166
Locus	cfp2166
Reference	Paux E et al. (2008) A Physical Map of the 1-Gigabase Bread Wheat Chromosome 3B Science 322:101-104.
Type	PCR
PCR primers	Left (5'-3'):CGCTTAGTGTGGAATGGATCT Right (5'-3'):CTTCCACGCCAAGGAAAGT
STS size	162
Sequence	DX369445