Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0504

[Submit comment/correction]

Locus	Bmag0504
Type	Microsatellite
Chromosome	1H
Map	Barley-ConsensusFHB-1H 49.8 Hordeum-Consensus2007-SSR-1H 49.18 Hordeum-LxHs-1H 77
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0504 Bmag504
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AG)6,(GAGG)4, (GA)7 Polymorphic Information Content (PIC) = 0.35 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	Bmag504
Locus	Bmag0504
Synonym	Other name Bmag0504
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)6,(GAGG)4,(GA)7 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.35
Type	PCR SSR
PCR primers	5' TTGTCTCAATCTTGATCACAC 3' 5' CAAAGAACATAAAGAGCACAA 3'
SSR size	157
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare