Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0003c

[Submit comment/correction]

Locus	Bmag0003c
Type	Microsatellite
Chromosome	2H
Map	Barley-ConsensusFHB-2H 83.47 Hordeum-Consensus2007-SSR-2H 86.39 Hordeum-LiHs-SNP-2H 73.68 Hordeum-LxHs-2H 58
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Lina x H.spont, SNP Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0003
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AG)28 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag0003 Bmag0003a Bmag0003b
Probe for Locus	Bmag0003
Locus	Bmag0003 Bmag0003c Bmag0003b Bmag0003a
Synonym	Other name Bmag3
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	GATCAAAGAGAACATGCGAT GTAGTTCAGCATAGACCTACAGG