Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0303e

[Submit comment/correction]

Locus	Bmac0303e
Type	Microsatellite
Chromosome	7H
Map	Barley-ConsensusFHB-7H 77.8 Hordeum-Consensus2007-SSR-7H 72.93 Hv-Consensus2006-Marcel-7H 72.93 Hv-Integrated2009-7H 77.3
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	Bmac0303 Bmac303
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Possible Orthologs	Bmac0303 Bmac303 Bmac0303a Bmac0303b Bmac0303c
Probe for Locus	Bmac0303
Locus	Bmac0303 Bmac0303c Bmac0303b Bmac0303e Bmac0303a
Synonym	Other name Bmac303
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	CCTCCAAGATTAGATCTCTCTC CCGTATATTTAAGAAATGGTGA