Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0156

[Submit comment/correction]

Locus	Bmac0156
Type	Microsatellite
Chromosome	1 (7H) 7H
Map	Barley-ConsensusFHB-7H 142.46 [ Show all 12 ]
	[ Show Nearby Loci ]
Map Data	Barley, Cali-sib x BowmanBC, QTL [ Show all 12 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0156 Bmac156
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Possible Orthologs	Bmac156
Probe for Locus	Bmac156
Locus	Bmac0156 Bmac156
Synonym	Other name Bmac0156
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)22(AT)5 Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products Diversity Index (DI) = 0.89
Type	PCR SSR
PCR primers	5' AACCGAATGTATTCCTCTGTA 3' 5' GCCAAACAACTATCGTGTAC 3'
SSR size	139
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare