Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0144f

[Submit comment/correction]

Locus	Bmac0144f
Type	Microsatellite
Chromosome	2H
Map	Barley-ConsensusFHB-2H 83.47 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel [ Show all 7 ]
Species	Hordeum vulgare
Probe	Bmac0144 Bmac144
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmac0144 [ Show all 13 ]
Probe for Locus	Bmac0144
Locus	Bmac0144 [ Show all 13 ]
Synonym	Other name Bmac144
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	TACGTGTACATACTCTACGATTTG ACTTATTCTGCATCCTGGGT