Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: AWBMS33

[Submit comment/correction]

Locus	AWBMS33
Chromosome	5H
Map	Hordeum-Consensus2006-DArT-5H 121.9
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of AWBMS33 in the Barley, Consensus 2006 DArT maps = 1
Probe	AWBMS33
Locus	AWBMS0033
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type	SSR
PCR primers	ACGGCCTCGTCGTCA ATGCCTGCAGGTCGACTCTA