Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: AM83

[Submit comment/correction]

Locus	AM83
Type	Microsatellite
Map	Oat-2002-KxO-Pal_30 5.34 Oat-2009-KxO_5_30 107 Oat-2016-Consensus-6 104.5 Oat-2018-Consensus_Mrg06 104.5 Oat-AxM-DH2008-7 79
	[ Show Nearby Loci ]
Map Data	Oat, AxM Doubled Haploid, 2008 Oat-2002-KxO_Pal Oat-2009-KxO Oat-2016-Consensus Oat-2018-Consensus
Species	Avena sativa
Probe	AM83
Reference	Tanhuanpaa P et al. (2008) The first doubled haploid linkage map for cultivated oat. Genome 51:560-569.
Probe	AM83
Locus	AM83 AM83-1
Reference	Pal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
Remarks	Insert contains repeats (AC)11
Type	SSR Microsatellite
PCR primers	5' CACTGCCATACATTCTGTCG 5' CCTCTACCGCAAAGGAAGAA
SSR size	190
Amplification Conditions	55
Specificity	Polymorphism among 13 Avena species is Yes
Source Species	Avena sativa
Source Germplasm	Clintland 64 (oat)