Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: AM102

[Submit comment/correction]

Locus	AM102
Type	Microsatellite
Map	Oat-2002-KxO-Pal_22 148.99 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Oat, AxM Doubled Haploid, 2008 [ Show all 7 ]
Species	Avena sativa
Probe	AM102
Reference	Tanhuanpaa P et al. (2008) The first doubled haploid linkage map for cultivated oat. Genome 51:560-569.
Probe	AM102
Locus	AM102
Reference	Pal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
Remarks	Insert contains repeats (AC)9
Type	SSR Microsatellite
PCR primers	5' TGGTCAGCAAGCATCACAAT 5' TGTGCATGCATCTGTGCTTA
SSR size	213
Amplification Conditions	55
Specificity	Polymorphism among 13 Avena species is Yes
Source Species	Avena sativa
Source Germplasm	Clintland 64 (oat)