Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG8

[Submit comment/correction]

Locus	ABG8
Type	RFLP
Synonym	Synonym ABG008
Chromosome	2H
Chromosome Arm	2HS
Map	Barley-Consensus-2H -50.1 [ Show all 7 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QMe.StMo-2H.2
Map Data	Barley consensus [ Show all 7 ]
Probe	ABG8
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	ABG008 ABG008-2H Xabg8-2
Probe	ABG8
Locus	Xabg8-2 ABG8 ABG008 ABG008-2H
Type	Genomic STS
PCR primers	GTTTATGTTTTCCAATTCAT TTAACAACTGATGTGTGAGT
Sequence	BH854349 BH854350 ABG8-5 ABG8-3
Linkage Group	2
Source Species	Hordeum vulgare
Source Germplasm	Shin Ebisu 16
Insert Size	1.5