Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG712

[Submit comment/correction]

Locus	ABG712
Type	RFLP
Synonym	Synonym Rph9 (Hordeum)
Chromosome	5H
Chromosome Arm	5HL
Map	Barley-consensus-2003-5H 38.5 [ Show all 21 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QMe.SlAl-5H.1 QSss.HaTR-5H.1
Map Data	Barley consensus [ Show all 21 ]
Probe	ABG712
Associated Gene	Rph9 (Hordeum)
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Kleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG712 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Gene Associated with Locus	Rph9 (Hordeum)
Locus	ABG712 Rph9
URL	Gene report page at the International Database for Barley Genes and Barley Genetic Stocks (NordGen)
Probe	ABG712
Locus	ABG712
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	AAATATGGTTGGTCAAAGTT GCTTCTGGTCTGTGTTCTTG
Sequence	L44092 ABG712
Source Species	Hordeum vulgare