Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG702B

[Submit comment/correction]

Locus	ABG702B
Type	RFLP
Chromosome	1H 5H
Chromosome Arm	1HL
Map	Barley-consensus-2003-5H 30.1 [ Show all 6 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QDP.ANWI-5H QMe.HaMo-1H.2 QMe.nab-1H.2 QTw.HaMo-1H QYld.HaMo-1H.1
Map Data	Barley consensus 2 [ Show all 6 ]
Probe	ABG702
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG702b in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	ABG702 ABG702(A) ABG702(B) ABG702a
Probe for Locus	ABG702
Locus	ABG702 ABG702B ABG702a ABG702(A) ABG702(B)
Synonym	Synonym HAR35_25320 HAR35_30748 HAR35_6023
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TCATGTACGTCGGCCATCTC CCGAGAAAACATCAAACCTG
Sequence	L44085 ABG702
Source Species	Hordeum vulgare