Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG462

[Submit comment/correction]

Locus	ABG462
Type	RFLP STS
Synonym	Synonym ABG462
Chromosome	3H
Chromosome Arm	3HS
Map	Barley-Consensus-3H -0.9 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHd.HaMo-3H QHt.HaMo-3H.2 QHt.HaMo-3H.3
Map Data	Barley consensus [ Show all 13 ]
Probe	ABG462
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Close, Timothy J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	Xabg462-3
Probe	ABG462
Locus	Xabg462-3 ABG462
Synonym	Synonym HAR35_33368 HAR35_810 HAR35_811
Remarks	Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GCTAACGGTGAGCAGCCCGT 5' GATAAGCCTGCACCCGTGCT
STS size	ca. 600
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	BH854358 BH854359 ABG462-5 ABG462-3
Linkage Group	Group 3
Source Species	Hordeum vulgare
Insert Size	1.1