Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG317

[Submit comment/correction]

Locus	ABG317
Type	RFLP
Synonym	Synonym ABG317A ABG317B
Chromosome	2H
Map	Barley-Consensus2-2H 136 Barley-ConsensusFHB-2H 140.23 Hordeum-HxT-base-2H 195.4 Hordeum-NABGMP2-2H 223.4 Hordeum-Zhedar2-FHB-QTL-2H 231
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, Consensus 2023, FHB Barley, HxT Barley, HxT basemap Barley, Zhedar2, FHB QTL
Probe	ABG317
Possible Orthologs	ABG317A ABG317B
Probe	ABG317
Locus	ABG317 ABG317A ABG317B
Synonym	Please see p3V
External Databases	DDBJ EMBL GenBank
Remarks	Verify plasmid by cutting w/HEB: this chops up the insert and leaves the vector intact. The pieces add up to 2.7kb.
Type	STS
PCR primers	CATGATGGGTCAAGCTCTGT AACTCTGGGTGGTTTGTGAA
Sequence	L43976 ABG317
Linkage Group	2
Source Species	Hordeum vulgare
Insert Size	2.7