Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC622

[Submit comment/correction]

Locus	ABC622
Type	CAPS RFLP
Synonym	Synonym ABC622
Chromosome	5H
Map	Barley-Consensus2-5H 172.5 [ Show all 17 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QFhs.dah-5H.1 QTw.HaTR-5H.2
Map Data	Barley consensus 2 [ Show all 17 ]
Species	Hordeum vulgare
Probe	ABC622
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of ABC622 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Cebada Capa x SusPtrit Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Probe	ABC622
Locus	ABC622
Synonym	Synonym HAR35_14621 HAR35_37640
External Databases	DDBJ EMBL GenBank
Type	STS
PCR primers	TCATCAAATGGCAAGTTGTA ACTCTGGCATGGTCAGTTGT
Sequence	L43960 ABC622
Source Species	Hordeum vulgare