Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC322B

[Submit comment/correction]

Locus	ABC322B
Type	RFLP
Synonym	Synonym ABC322
Chromosome	1H
Map	Barley-Consensus2-1H 137.7 [ Show all 15 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QABA.StMo-1H
Map Data	Barley consensus 2 [ Show all 15 ]
Probe	ABC322
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC322B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABC322A
Probe for Locus	ABC322
Locus	ABC322B HD084P24 ABC322A
Synonym	Synonym HAR35_8900
External Databases	DDBJ EMBL GenBank
Type	STS
PCR primers	ACATTGTTCAGTGCTGATTC ATCAGGCTGGTATCTGTTTC
Sequence	L43950 ABC322
Polymorphism	ABC322 EcoRI
Source Species	Hordeum vulgare