Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC308

[Submit comment/correction]

Locus	ABC308
Type	RFLP
Synonym	Synonym ABC308
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-Consensus-7H -1 [ Show all 18 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 18 ]
Probe	ABC308
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC308 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABC308(A) ABC308(B) ABC308a ABC308b
Probe	ABC308
Locus	ABC308 ABC308a ABC308b ABC308(B) ABC308(A)
Synonym	Synonym HAR35_5064
External Databases	DDBJ EMBL GenBank
Type	cDNA STS
PCR primers	ACATGGTGCCATTCACAAAT CCTCGCTGAAACTAATCAAA
Sequence	L43947 ABC308
Source Species	Hordeum vulgare