Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC175

[Submit comment/correction]

Locus	ABC175
Type	RFLP
Synonym	Synonym ABC175 POPA2_0620
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-6H 59.3 [ Show all 21 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 21 ]
Probe	ABC175
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABC175 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	ABC175B [ Show all 8 ]
Probe	ABC175
Locus	ABC175B [ Show all 11 ]
Synonym	Synonym HAR35_1958
Type	cDNA STS
STS primers	5' CAGTTTACAAGTGCAGAGGT 5' GAACAGAAGCAGAAGATCGA
STS size	270
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	BQ548059 ABC175-5
Source Species	Hordeum vulgare