Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC165D

[Submit comment/correction]

Locus	ABC165D
Type	RFLP
Chromosome	6H 7H
Map	Hordeum-Bins-6H 83 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 [ Show all 6 ]
Species	Hordeum vulgare
Probe	ABC165
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Possible Orthologs	ABC165 ABC165-2H ABC165A ABC165C
Probe for Locus	ABC165
Locus	ABC165 ABC165C ABC165D ABC165A ABC165-2H
External Databases	DDBJ EMBL GenBank
General Remarks	Steptoe malt cDNA
Type	cDNA STS
PCR primers	CAATGACTTCAAGGGGTCTG TCCATACCATTCCCATCTAA
Sequence	L43932
Linkage Group	Group 2 2
Source Species	Hordeum vulgare
Source Germplasm	Steptoe (barley)
Source Tissue	malt
Insert Size	0.5