Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC06204

[Submit comment/correction]

Locus	ABC06204
Type	STS
Chromosome	6H
Map	Hordeum-RxK-NTNB-6H 41.6
	[ Show Nearby Loci ]
Map Data	Barley, Rika/Kombar NTNB, 6H
Species	Hordeum vulgare
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270.
Probe	ABC06204
Locus	scsnp06204
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
PCR primers	TCAAAGTGGGCAGGCATCAA ATCATGACCCGATGCGGTG