Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Locus Report: k08148

[Submit comment/correction][What is a locus?] A genetic locus is a specific position on a chromosome where a gene or genetic marker is located.

Locus	k08148  [ Marker Report ]
Type	CAPS
Probe	BaGS35A09
Chromosome	3H
Map	Hv-HNxH602-3H 57.4
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	Restriction enzyme used for CAPS analysis = SacII SNP = A/G SNP structure (UNICODE) = TGGTGGCAACRAGCTCCATCA Parent 1 SNP sequence = TGGTGGCAACAAGCTCCATCA Parent 2 SNP sequence = TGGTGGCAACGAGCTCCATCA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.