Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: TraesCS7D01G080400

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	TraesCS7D01G080400
Locus	TraesCS7D01G080400.1
URL	[ Hide all but 1 of 9 ] Pfam PF00067 InterPro IPR001128 InterPro IPR002401 InterPro IPR017972 Gene Ontology GO:0005506 Gene Ontology GO:0016705 Gene Ontology GO:0020037 Gene Ontology GO:0055114 Gene expression at wheat-expression.com (expVIP)
Reference	Fang T et al. (2020) Development and deployment of KASP markers for multiple alleles of Lr34 in wheat Theoretical and Applied Genetics 133:2183-2195. IWGSC et al. (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome Science 361.
General Remarks	BLAST Hit Accession: tr|C0JSA9|C0JSA9_WHEAT Human Readable Description: Cytochrome P450 Pfam IDs Description: PF00067: Cytochrome P450 InterPro IDs Description: IPR001128: Cytochrome P450; IPR002401: Cytochrome P450, E-class, group I; IPR017972: Cytochrome P450, conserved site GO IDs Description via InterPro: GO:0005506 MF: iron ion binding; GO:0016705 MF: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen; GO:0020037 MF: heme binding; GO:0055114 BP: oxidation-reduction process
Type	Genomic PCR
PCR primers	Forward 5' CGGATCTTCCTGCAGCTA Reverse 5' GTCCTTGGTGAAGATGAATGCA
Sequence	TraesCS7D01G080400.1
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring