Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scssr14079

[Submit comment/correction]

Locus	scssr14079
Type	Microsatellite SNP
Synonym	Other name Ctig8511 Synonym ABC14079_L01R01
Chromosome	4H
Map	Barley-ConsensusFHB-4H 88.96 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 9 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP
Species	Hordeum vulgare
Probe	ABC14079_L01R01 scssr14079
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe for Locus	ABC14079_L01R01
Locus	scssr14079
Data at Germinate	ABC14079
General Remarks	Estimated product size = 102 BarleySNP type = Contig Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc14079
PCR primers	5' AAAATAAGGTTTCTTGTTCTTGG 5' GAAACCCTGTTGAAGTACGG
Source Species	Hordeum vulgare