Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scind02622

[Submit comment/correction]

Locus	scind02622
Type	Indel Microsatellite
Synonym	Other name SNP3162 Synonym ABC02622_L02R02
Chromosome	2H
Map	Barley, B73xCPI-2H 7 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, B73xCPI Barley, Consensus 2005, SNP Barley, Integrated, Marcel 2009 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP
Species	Hordeum vulgare
Probe	ABC02622_L02R02 scind02622
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC02622_L02R02
Locus	scind02622
Data at Germinate	ABC02622
Data at PLEXdb	Barley1_02622
General Remarks	Estimated product size = 293 BarleySNP type = EST Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc02622
Type	STS
PCR primers	5' TCATGCATGGTAGAGGTCCA 5' TTGAGAACCACTCGTCAGGA
Sequence	Barley1_02622
Source Species	Hordeum vulgare