Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: mwg068

[Submit comment/correction]

Locus	mwg068
Type	RFLP
Chromosome	1H
Chromosome Arm	1HS
Map	Hordeum-Bins-1H 24 Hordeum-Wise-1H 7
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Wise
Probe	MWG68
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	MWG68 [ Show all 8 ]
Probe for Locus	MWG68
Locus	[ Hide all but 1 of 10 ] Xmwg68-1 Xmwg068 Xmwg68-1B mwg068 Xmwg68 Xmwg68a Xmwg68b MWG68 mwg68 mwg68-1B
General Remarks	single - low copy probe
Type	Genomic PCR STS
PCR primers	R:GGTGAGCTGCGCCAGTTCTA L:CCCATGCCATAGTCCTGGGAA
Amplification Conditions	Anneal at 45oC.
Polymorphism	MWG68 EcoRI MWG68 EcoRV MWG68 HindIII MWG68 XbaI
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.58