Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuA1B

[Submit comment/correction]

Locus	ksuA1B
Type	RFLP
Synonym	Synonym srh (Hordeum)
Chromosome	2H 5H
Map	Barley-consensus-2003-2H 17.8 [ Show all 13 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHt.HaTR-5H.2
Map Data	Barley consensus 2 [ Show all 13 ]
Probe	pTtksuA1
Associated Gene	srh (Hordeum)
Gene Class	Short rachilla hair
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Kleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	[ Hide all but 1 of 24 ] A001 ksuA1 ksuA1(A) ksuA1(B) ksuA1(C) ksuA1(D) ksuA1A ksuA1a-7H ksuA1c ksuA1d ksuA1e ksuA1f ksuA1g ksuA1h XksuA1 XksuA1-1B XksuA1-3B XksuA1-5B XksuA1-7D XksuA1a XksuA1B XksuA1c KSU_A1 ksuA1-5B
Probe for Locus	pTtksuA1
Locus	Xksu-A1 [ Show all 26 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGATTGTCAACAAGTGCC L:CAACAGAGATATTGCCGTAG
Polymorphism	KSUA1 DraI KSUA1 XbaI KSUA1 EcoRI KSUA1 EcoRV KSUA1 HindIII
Linkage Group	7D / 7DS Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.2