Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuA1

[Submit comment/correction]

Locus	ksuA1
Type	RFLP
Chromosome	5H
Map	Hordeum-Consensus2006-DArT-5H 86.3 Hordeum-CxS-5H 96.64 Hordeum-GxH-5H 107.56 Oat-KxO/2003-19+27 20 Wheat, Yr genes and QTL 5B 39.3
	[ Show Nearby Loci ]
QTL with Locus Marker	QSr.CaBo-5H
Map Data	Barley, Consensus 2006, DArT Barley, CxS Barley, GxH Oat, KxO, 2003 Wheat, Yr genes and QTL
Probe	pTtksuA1
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of ksuA1 in the Barley, Consensus 2006 DArT maps = 1 Marker placement value = 3.44 cM on map Oat-KxO/2003-19+27 Marker is not a framework marker on map Oat-KxO/2003-19+27
Possible Orthologs	A001 [ Show all 24 ]
Probe for Locus	pTtksuA1
Locus	[ Hide all but 1 of 26 ] Xksu-A1 XksuA1-1B XksuA1-5B XksuA1-7D XksuA1 A001 ksuA1A ksuA1B ksuA1 XksuA1-3B XksuA1c XksuA1B XksuA1a ksuA1d ksuA1c ksuA1e ksuA1f ksuA1g ksuA1h ksuA1(C) ksuA1(D) ksuA1(B) ksuA1(A) ksuA1-5B ksuA1a-7H KSU_A1
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGATTGTCAACAAGTGCC L:CAACAGAGATATTGCCGTAG
Polymorphism	KSUA1 DraI KSUA1 XbaI KSUA1 EcoRI KSUA1 EcoRV KSUA1 HindIII
Linkage Group	7D / 7DS Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.2