Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG729

[Submit comment/correction]

Locus	cMWG729
Type	RFLP
Synonym	Synonym POPA2_0060
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-Consensus-7H 8.3 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	cMWG729
Data Source	Kleinhofs, Andris
Remark	[ Hide all but 1 of 6 ] This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin This marker is a Binlocus 0in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Changed from cMAWG729 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	cMWG729-7H
Probe	cMWG729
Locus	cMWG729 cMWG729-7H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' ATGGCAAGCCAACAAACATC 5' GTTGCGTCCATAATTCAGAGG
STS size	76
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BQ548053 BQ548052 CMWG0729-5 CMWG0729-3
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf