Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG716a

[Submit comment/correction]

Locus	cMWG716a
Type	RFLP
Chromosome	5H
Map	[ Hide all but 1 of 7 ] Barley-Consensus2-5H 140.8 Barley-ConsensusFHB-5H 139.67 Hordeum-Bins-5H 139 Hordeum-Consensus2007-SSR-5H 125.73 Hordeum-Graner2-5H 152.7 Hv-Consensus2006-Marcel-5H 125.73 Hv-Integrated2009-5H 123.7
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 7 ]
Species	Hordeum vulgare
Probe	cMWG716
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	cMWG716 cMWG716a-5H cMWG716b cMWG716b-6H
Probe for Locus	cMWG716
Locus	cMWG716a [ Show all 18 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' CCTGGGAGGTGAAGTTGGCT 5' GACCAGATCAACGAGCCCAA
STS size	335
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234435 AJ234434 CMWG716-5 CMWG716-3
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf