Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG649b

[Submit comment/correction]

Locus	cMWG649b
Type	RFLP
Chromosome	1H
Map	Barley-Consensus2-1H 105.7 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley consensus 2 Barley genes Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, VGxTP
Species	Hordeum vulgare
Probe	cMWG649
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	cMWG649 [ Show all 7 ]
Probe for Locus	cMWG649
Locus	cMWG649b [ Show all 10 ]
Synonym	Other name MWG649 Kunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27. MWG649 Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256. Synonym HAR35_4916
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' CAACACTCCGTCAACCAGCAACCTC 5' GCCTGCGTTGTTGAATGCG
STS size	441
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234403 CMWG649-5
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf