Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuH16-2D

[Submit comment/correction]

Locus	XksuH16-2D
Type	RFLP
Chromosome	2D
Chromosome Arm	2DL
Map	[ Hide all but 1 of 7 ] Ta-Gale-2D 61.6 Ta-Synthetic/Opata-2D 188.1 Ta-Synthetic/Opata-BARC-2D 78.2 Ta-Synthetic/Opata-DR-2D 59.4 Ta-Synthetic/Opata-gbx-2D 182.9 Ta-Synthetic/Opata-GPW-2D 188.2 Ta-Synthetic/Opata-SSR2-2D 209.4
	[ Show Nearby Loci ]
Map Data	Wheat, Gale [ Show all 7 ]
Probe	pTtksuH16
Image	KSUH16 SO autoradiogram
Possible Orthologs	H016 [ Show all 7 ]
Probe for Locus	pTtksuH16
Locus	XksuH16 [ Show all 10 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:CACCTTCTTCTTCTTCTACT L:ACACTCTTCATTGGCATCTC
Polymorphism	KSUH16 EcoRV [ Show all 6 ]
Linkage Group	2D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.4